$ loading_
Analyze sequences and design molecular biology workflows for DNA, RNA, and proteins.
Copy the install command and let the AI configure it · recommended for beginners
Please install the "com.seqbench/workbench" MCP server from askskill: Run: claude mcp add --transport http 'com-seqbench-workbench' 'https://seqbench.com/api/mcp'
Design a pair of PCR primers for the following DNA template. Target amplicon length should be 300-500 bp, Tm between 58-62°C, and avoid obvious dimers or hairpins. Provide primer length, GC content, and expected product size for each primer: ATGCGTACCTGACCTGATCGTACGATCGTAGCTAGCTGATCGATCGTACGATCG
Returns forward and reverse primer suggestions with key quality metrics.
Find candidate sgRNA target sites for SpCas9 in the following gene sequence. Prioritize sites near the first exon, and list the PAM, target sequence, GC content, and any off-target risk notes: GACCTGATCGTAGCTAGGCTTACCGGATCGTACCGGATGCTAGCTAGGATCCGATCGTAGC
Provides multiple candidate CRISPR targets with selection rationale for follow-up validation.
Run batch alignment on the following 20 protein sequences, identify conserved regions, and summarize similarity differences versus the reference sequence. If possible, provide output formatted for downstream phylogenetic analysis.
Returns batch alignment results, conserved-site summaries, and structured data for downstream analysis.
Search, map, and analyze non-coding RNA sequences from RNAcentral.
Get oriented with your bio-research setup, connected tools, and analysis skills.
Run AlphaFold3 protein predictions, variant batches, and job monitoring via Docker.
Query MGnify genomes and run KEGG annotation and module completeness analysis.
Query genomic databases, run sequence searches, and log reproducible bioinformatics evidence.
Query genes, sequences, variant effects, orthologs, and annotations via Ensembl.